Review



pr1  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    OriGene pr1
    Pr1, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/bio_rxiv__64898__2026__05__07__723586-99-16-15?v=OriGene
    Average 95 stars, based on 50 article reviews
    pr1 - by Bioz Stars, 2026-08
    95/100 stars

    Images



    Similar Products

    pr1  (OriGene)
    95
    OriGene pr1
    Pr1, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/bio_rxiv__64898__2026__05__07__723586-99-16-15?v=OriGene
    Average 95 stars, based on 1 article reviews
    pr1 - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier
    tgccagtcagaagaacgacc  (OriGene)
    95
    OriGene tgccagtcagaagaacgacc
    Tgccagtcagaagaacgacc, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/bio_rxiv__2025__08__28__672891-224-23-35?v=OriGene
    Average 95 stars, based on 1 article reviews
    tgccagtcagaagaacgacc - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier
    gfp fragment  (OriGene)
    95
    OriGene gfp fragment
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Gfp Fragment, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/pm40489329-530-11-17?v=OriGene
    Average 95 stars, based on 1 article reviews
    gfp fragment - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier
    crispra  (OriGene)
    93
    OriGene crispra
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Crispra, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/pm39889695-793-4-14?v=OriGene
    Average 93 stars, based on 1 article reviews
    crispra - by Bioz Stars, 2026-08
    93/100 stars
    		  Buy from Supplier
    crispri  (OriGene)
    93
    OriGene crispri
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Crispri, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/pm39889695-793-9-14?v=OriGene
    Average 93 stars, based on 1 article reviews
    crispri - by Bioz Stars, 2026-08
    93/100 stars
    		  Buy from Supplier
    crispri vectors  (OriGene)
    93
    OriGene crispri vectors
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Crispri Vectors, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/pm39889695-790-13-16?v=OriGene
    Average 93 stars, based on 1 article reviews
    crispri vectors - by Bioz Stars, 2026-08
    93/100 stars
    		  Buy from Supplier
    grnas  (OriGene)
    95
    OriGene grnas
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Grnas, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/pm40069152-452-3-12?v=OriGene
    Average 95 stars, based on 1 article reviews
    grnas - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier
    pcas guide ef1a gfp vector  (OriGene)
    95
    OriGene pcas guide ef1a gfp vector
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Pcas Guide Ef1a Gfp Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/pm39934299-66-33-35?v=OriGene
    Average 95 stars, based on 1 article reviews
    pcas guide ef1a gfp vector - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier
    sequence 3  (OriGene)
    95
    OriGene sequence 3
    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of <t>BMDMs</t> <t>(tdTOMATO+;</t> red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from <t>MC38-OVA-GFP,</t> β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.
    Sequence 3, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcas+guide+gfp/bio_rxiv__2025__01__08__632037-205-5-12?v=OriGene
    Average 95 stars, based on 1 article reviews
    sequence 3 - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of BMDMs (tdTOMATO+; red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from MC38-OVA-GFP, β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.

    Journal: Cell reports

    Article Title: Distinct TAM subset with cross-dressing capability determines the bifurcation of tumor immunity.

    doi: 10.1016/j.celrep.2025.115800

    Figure Lengend Snippet: Figure 3. Acquisition of tumor antigens by TAMs via trogocytosis (A) Trogocytosis activity. BMDMs were co-cultured with CellMask-labeled MC38 cells for 1 h, and CellMask + BMDMs were analyzed using flow cytometry (mean ± SEM, n = 4). (B) Time-lapse imaging of BMDMs (tdTOMATO+; red) co-cultured with CellMask-labeled MC38 cells (green) during trogocytosis. (C) Comparison of trogocytic activity between tumor cells and macrophages (mean ± SEM, n = 3–6). (D and E) Phagocytosis vs. trogocytosis: CFSE-labeled CT26 cells (BALB/c) (live or UV irradiated) were co-cultured with B6-derived BMDMs for 8 h. Phagocytic (CFSE + ) and trogocytic (Kd + ) BMDMs were analyzed using flow cytometry. Representative (D) and summary (E) data are shown (mean ± SEM, n = 6). (F) Representative images of H2-Kb/SIINFEKL in TAMs from MC38-OVA-GFP, β2MKO MC38-OVA-GFP, or MC38-GFP stained with GFP (green), F4/80 (magenta), CD206 (cyan), and H2-Kb/SIINFEKL (red). White arrows indicate CD206 + F4/80 + H2-Kb/SIINFEKL + cells. Scale bar: 50 μm.

    Article Snippet: An all-in-one CRISPR/Cas9 vector with tdTomato was created by replacing the GFP fragment of the pCas-Guide-EF1a-GFP vector (Origene, Rockville, MD, USA) with a tdTomato fragment amplified via PCR, using the BmgBI and ClaI sites.

    Techniques: Activity Assay, Cell Culture, Labeling, Flow Cytometry, Imaging, Comparison, Irradiation, Derivative Assay, Staining